• Inicio
• Acerca de
• Iniciar sesión
• Buscar
• Actual
• Archivos
• Enviar manuscrito

Artículo Científico                                                                                                                                                                                                        Biotecnología Vegetal Vol. 10, No. 4: 209 - 218, octubre - diciembre, 2010

ISSN 1609-1841 (Versión impresa) 
 ISSN 2074-8647 (Versión electrónica)

Rafael G Kosky,¹ Borys Chong-Pérez¹, Jorge López-Torres², Maritza Reyes¹, Idalmis Bermúdez-Caraballoso¹, Nery Montalvo Martín², José M. Machado-Rodriguez¹, Orelvis Portal¹, Bárbara Ocaña¹, Yelenys Alvarado-Capó¹, Michel Leiva-Mora¹, Mayra Acosta-Suárez¹, Mileidy Cruz-Martin¹, Belkis Roque¹, Lázaro Hernández³ *Autor para correspondencia

¹Instituto de Biotecnología de las Plantas (IBP), Universidad Central ‘Marta Abreu’ de Las Villas. Carretera a Camajuaní km 5.5. Santa Clara, Villa Clara. Cuba. CP 54 830 e-mail: kosky@ibp.co.cu

²Instituto Nacional de Investigaciones en Viandas Tropicales (INIVIT). Ministerio de la Agricultura. Santo Domingo, Villa Clara. Cuba.

³Centro de Ingeniería Genética y Biotecnología (CIGB). Ciudad de La Habana. Cuba.

ABSTRACT

The present work was carried out with the objective to obtain plantain transgenic plants of ‘Navolean’ (Musa AAB) cultivar and to evaluate them, under field conditions during the first crop cycle, for Black Sigatoka disease. Embryogenic cell suspensions obtained from scalp were used for the transformation by Agrobacterium tumefaciens. The bacterial strain EHA-105 was used with the binary plasmid pHGA-91, which contained a combination of genes that encode for the antifungal glucanase enzyme and the AP24 osmotin. Twenty putative transformed lines of the construct were obtained after two months of selection in the culture medium. The transgenic events were verified by means of PCR and Southern hybridisation. These confirmed the stable integration and expression of the transgenes in transgenic plants that were selected in field showing differences with non-transgenic plants used as control.

Key words: genetic transformation, AP24, glucanase, Musa, Mycosphaerella fijiensis

RESUMEN

El presente trabajo fue realizado con el objetivo de obtener plantas transgénicas de plátano cultivar ‘Navolean’ (Musa AAB) y evaluar estas bajo condiciones de campo durante el primer ciclo de cultivo para la enfermedad Sigatoka negra. Suspensiones celulares embriogénicas obtenidas desde domos meristematicos fueron usadas para la transformación por Agrobacterium tumefaciens. La cepa de bacteria EHA-105 fue utilizada con el plásmido binario pHGA-91, el cual contenía combinaciones de los genes que codifican para las antifúngicas enzimas glucanasa y la osmotina ap24. Veinticuatro putativas líneas transformadas fueron obtenidas después de dos meses de selección en medio de cultivo. Lo eventos transgénicos fueron verificados por la vía de PCR e hibridación Southern y estos confirmaron la integración estable y expresión del transgén en las plantas transgénicas que fueron seleccionadas en el campo y que mostraron diferencias con las plantas no transgénicas usadas como control.

Palabras clave: transformation genética, ap24, glucanasa, Musa, Mycosphaerella fijiensis

INTRODUCTION

The area of transgenic crops experienced a growth record in 2004, reaching a total of 81 million hectares. According to James (2004) the global area of transgenic crops grew by 13.3 million hectares in 2004, that is almost 20% increase with regard to 2003. The main crops were Soybean, Maize, Cotton and Canola, however, so far commercial GM crop of importance do not exist for food in developing countries.

The cultivation of bananas and plantains are broadly distributed in the tropical and subtropical regions of the world. The production is about 700 million tons per year with a calculated area planted of 10 million hectares. This crop is part of the alimentary diet for more than 400 million people and it is in the fourth place in the category of nutritious products of great demand after rice, corn and wheat (FAO, 2003). Black leaf streak (Mycosphaerella fijiensis Morelet) is the most damaging disease for Musa plantation in the world, including Cuba. It is present in all areas of the country and it replaced Yellow Sigatoka Disease (Mycosphaerella musicola) (Pérez, 2003).

Chemical control and cultural practices reduce the affectation but does not solve the problem. Genetic transformation techniques represent an alternative to obtain Musa genotypes resistant to Black leaf streak (Swennen, 2003). Evaluation of transgenic plants in the field is an important step in the selection strategy.

Pérez (2000) reported Agrobacterium-mediated transformation of embryogenic cell suspensions from different banana and plantain cultivars. Another work has been reported by; Khanna et al. (2004) for ‘Grande Naine’ (AAA) and ‘Lady Finger’ (AAB) banana cultivars and Chong- Pérez et al. (2002) for plantain hybrid ‘FHIA-21’ (AAAB) and Ganapathi et al. (2001) for cv. ‘Rasthali’ (AAB). Arinaitwe et al. (2004) reported the comparative study between Agrobacterium and particle bombardment-mediated transformation of four banana and plantain cultivars.

Cohen (2005) points out the existence of field trials with transgenic banana and plantain plants in some countries (Philippines, Mexico and Costa Rica) although in this case the plants are reported transformed with the fungal resistance genes. Only Gómez-Lim et al. (2004) mentioned the evaluation of Musa transgenic plants in field with antifungal genes, but in banana cultivars.

The present work was carried out with the objective to obtain and to evaluate the plantain transgenic plants from ‘Navolean’ (AAB) cultivar with the use of genetic transformation via Agrobacterium tumefaciens.

MATERIALS AND METHODS

Genetic transformation

Cell suspension cultures

Embryogenic cell suspensions (ECSs) were started from somatic embryo groups. These were obtained from scalps in ZZ semisolid culture medium and maintained according to the methodology described by Cabrera (2002) and Strosse et al. (2003) for the plantain cultivar ‘Navolean’ (Musa AAB).

Bacterial strain, plasmids and culture conditions

The EHA-105 strain of Agrobacterium tumefaciens was used carrying the pDUBAR binary vector (Figure 1). This vector was acquired from Biotechnology and Genetic Engineer Centre (CIGB) in Havana, Cuba. The bacterial cultures were previously grown on LB medium (10 g l^-1 tryptone, 5 g l^-1 yeast extract, 10 g l^-1 Sodium chloride) during 24 hours at 28^oC and 200 rpm. Appropriate antibiotics were included in the medium: rifampicin, ampicillin and streptomycin each at 50 mg l^-1 and spectinomycin at 300 mg l^-1.

The cell culture was centrifuged to 4300 rpm during 10 min and the bacterial pellet was re-suspended in induction medium (AB salts 20X, 2 mM NaH₂PO₄, 30 mM MES, 1% glucose, 200 ìM acetosyringone, pH 5.6) with the appropriate antibiotics (Pérez, 2000). The culture was incubated at 28^oC and 200 rpm overnight to reach approximately an OD₆₀₀ = 1.0.

Inoculation and co-cultivation

The induced bacterial culture was transferred to induction medium free from antibiotics and diluted to an OD₆₀₀ of 0.5-0.6 before infection of cells suspension. ECSs (150 ìl of cells), were used at a concentration of 33% SCV and mixed with 1 ml of the induced bacterial suspension 5 days after subculture. These were kept in darkness at 25^oC and 25 rpm for 2 hours.

The infected cells suspensions were placed on nylon meshes (200 ìm) under filter paper to eliminate excessive bacteria. The meshes were transferred to semisolid ZZ multiplication medium (Strosse et al., 2003) supplemented with acetosyringone (200 ìM) and pH 5.6. The co-culture remainet 3 days in the dark at 21^oC.

After co-culture, the cells were transferred to semisolid ZZl multiplication medium (Dhed’a et al., 1991) supplemented with 200 mg l^-1 timentine and 6 mg l^-1 BASTA^®. The cells remained in this medium for two months with subcultures every 15 days and incubated in the dark at 27^oC. After this time the transformants were transferred to embryo formation medium RD1 (Dhed’a et al., 1991). Embryos were formed in 1-2 months transferring then to the germination medium proposed by Kosky et al. (2000).

The putatively transformed in vitro plants were multiplied until obtaining 15-20 plants per line using M5 medium (medium proposed by Murashige and Skoog (1962) supplemented with 2.0 mg l^-1 6-BAP, 0.65 mg l^-1 IAA and 30 g l^-1 sucrose and rooted using M6 medium (Strosse et al., 2003): (medium proposed by Murashige and Skoog (1962) supplemented with 1.3 mg l^-1 IAA and 40 g l^-1 sucrose).

Acclimatization stage

Rooted plants were acclimatized according to Pérez et al. (1999) in a greenhouse covered with a plastic mesh, reducing light intensity to 30%. The plants were planted in Styrofoam trays of 70 orifices with a substrate composed of a mixture of casting and zeolite (3:1).

Irrigation was carried out with a microjet system, with a frequency of six irrigations per day each during 2 min. With this frequency a relative humidity of 85-90% was guaranteed.

Field evaluation

After 60 days in the acclimatization stage, 25 putative transgenic lines of the cultivar ‘Navolean’ (Musa AAB) (pHGA91) were planted in the Experimental Station in Remedios, Villa Clara, Cuba on ferralitic soil without an irrigation system. For field trials the National Biosafety Committee issued the Biological Security License.

A complete random design was used. Three replicates per line were selected, each one with three plants, using untransformed lines as controls. The parameters evaluated were done according to INIBAP Technical Guidelines 6 (Carlier et al., 2002).

Evaluation

Two evaluations were done: The first evaluation after four, five and six months of planting and the second one at shooting (bunch emergence). The following data were collected according to the criteria of Carlier et al. (2002):

•   Youngest leaf spotted (YLS): is the leaf number of the first unfurled leaf with at least 10 discrete, mature, necrotic lesions or one large necrotic area with 10 light-colored dry centers.

•  Number of functional leaves (NFL): Functional leaves are leaves that have photosynthetic activity. Considering that a leaf is functional if it has more than 50% of green area.

•   Number of total leaves (NTL)

•   Disease severity: leaves should be graded using Gauhl´s modification of Stover system. After an infection, index for each plant should be calculated (Only evaluated at shooting)

Molecular analysis

PCR analysis

Genomic DNA was isolated from plants of five putative transgenic lines, grown in field, with different according YLS the control untransformed. The Wizard Genomic DNA Purification Kit was used (Promega) with modifications in the extraction buffer: 100 mM Tris –HCl, pH=8; 50 mM EDTA, 500 mM NaCl, 10 mM β-ME (mercaptoethanol), 2% PVP (polyvinyl pyrrolidone, MW 10.000), as per manufacturer’s instructions. PCR with gene specific primers was used to confirm presence or absence of bar transgene.

The procedure followed:

PCR amplification: two micro liters of DNA preparation were used in a 20 μl reaction mixture containing buffer for Taq pol 10 X, 200 μM of each deoxynucleoside triphosphate (dATP, dTTP, dGTP and dCTP), 1μM of each primer, 1.5 mM MgCl₂ and 1 units Taq DNA polymerase in a 0.2 ml tube. The two deoxynucleotide primers were: barF: 20 nucleotides long, barR: 17 nucleotides long. The sequence of primer barF was: 5’ CCATCGTCAACCACTACATC 3’ and barR is: 5‘ AGAAACCCACGTCATGC 3’.

Reaction mixtures were placed in an automated thermal cycler (Mastercycler personal, Eppendorf), heated to 95 ⁰C for 2 minutes and subjected to 35 step cycles of 30 seconds at 95⁰C, 30 seconds at 55⁰C, 45 seconds at 72⁰C. The final incubation at 72⁰C was extended for 5 minutes. The reactions were stored at -20⁰C. A plasmid containing the pHCA58 construct was used as positive control and water control and non-transformed plants were used as negative controls.

PCR products were checked on Ethidium bromide stained 1.5 % agarose gel.

Southern blot analysis

Integration of transforming DNA from plasmid pHCA58 was analysed using Southern hybridisation to probe for presence of bar gene. Plasmid pHCA58 and genomic DNA from plants transformed with it were digested with EcoRI which cut the plasmid DNA as shown in Figure 2. Genomic digested (10 μg) and plasmid digests (5 pg) were separated by electrophoresis on a 0.8% (w/v) agarose gel run for approximately 4 hours at 40 V and transferred by capillary blotting onto positively charged nylon membrane. The HighBond N+ nylon membrane (Amersham) was wrapped in Saran wrap and baked for two hours at 80ºC. The membrane was left under vacuum overnight at room temperature (25-28ºC). The Gene Images random prime labelling kit and the Gene Images CDP-Star detection kit from Amersham were used to label a probe for the bar gene and detection events, respectively. A bar probe (20 ng/ml hybridization solution) was used for the hybridization. The membrane was hybridized overnight at 60°C according to the manual of Amersham Co. The blot was exposed overnight on X-Ray developing the film.

RESULTS AND DISCUSSION

Genetic transformation

Many cells were observed with brown to white coloration during subcultures. Cells aggregates did not grew in the control not transformed. The embryos in the globular state were visible on the surface of the embryogenic cell aggregates after four weeks of subculture in culture medium without BASTA®. Finally, the mature embryos were transferred to the germination culture medium and the coleoptiles emergency was observed after four to eight weeks.

A total of 25 putative transformed lines were obtained plasmid using (Table 1).

Field evaluation

First evaluation

Table 2 summarizes the results after four, five and six months after planting based on the youngest leaf spotted (YLS).

Results are average of nine plants per line. Control values were taken from plants in rows near to the putative transgenic plants.

After 6 months, putative transgenic lines showed YLS between 4.5 and 2.5. In the control plants, the YLS of ‘Navolean’ was around 3.9. The evidence at four and five months evaluation revealed a decreasing YLS with the plant age. It was noted at six months, too. No differences between transgenic lines and the control were observed.

Second evaluation in the field

The bunch emergence started in May. All plants of the same line had not flowered in June. The results of field evaluation in many putative transgenic plants at bunch emergence are showed in table 3.

Up to this point in the evaluation, one putative transgenic line with differences to the control was selected according to the infection index at bunch emergence (Table 4).

According to the results in the greenhouse as well as in field, a group of transgenic lines that present stages of maximum infection between 2 and 3 can be outlined (scale proposed by Alvarado-Capó et al., 2003) with artificial infection in greenhouse (data not shown). These manifested differences with the non-transgenic control in the greenhouse and field. However, taking into account the data of the variables evaluated up to the bunch emergence, much of these lines do not show these differences with the control. For this reason, Dr. Guzman of CORBANA (2004 personal communication), suggested that the variables that allow statistical differences are the infection index, and symptom evolution time, which should be included as the most important variable for the evaluations of the lines in field for next year (second cycle), so much for transgenic lines in second as well as the first evaluation cycle. Also the type of action of the quimeric genes in the cv. ‘Navolean’ have importance. These genes codified for protein accumulation in vacuole cell and they need the pathogen penetrates through the stomata of the leaf and begins the process of infection activating these genes. This explains much of the results obtained. Therefore, they will always appear in the supposedly resistant transgenic lines of first grades of infection of the disease.

From the total number of line (15), one was selected (6.6%) because it presented a superior response to Mycosphaerella fijiensis under field conditions when compared with the control of ‘Navolean’. Osmotin (AP24) antifungal activity is synergistic with chitinase and glucanase in vitro and in vivo (Veronese et al., 2003), which supports the results in this research. The Osmotin protein from tobacco causes perturbation in the regulation of fungal cell wall assembly (Yun et al., 1998). These are the first results reported in plantain transgenic plants evaluated in field with antifungal proteins.

Molecular analysis

DNA isolation and PCR analysis

The extracted DNA was checked by an electrophoresis on agarose gel, confirming its purity and integrity.

The bar gene could be amplified in several transformed lines(Figure 3). The bands of the transformed lines were the same to those of the plasmid (pHCA58), which was used as positive control. In the negative control (non-transformed plants) no band appeared. Those indicated that the bands of the transformed lines corresponded to the bar gene, which was introduced into the genome of the plants by the transformation events that took place. Out or the five putative transgenic lines selected for molecular analysis, 4 (80.0 %) were positive in the PCR (table 5).

Works carried out in this same crop by Remy et al. (2002) that regenerated a total of 157 in vitro differentiated plants of Musa spp., revealed the expression in eight individuals. Similar result was obtained by Daniels (2003), who achieved the expression in five of a total of seventy putative transgenic plants.

Southern blot analysis

All amplified DNA fragments reacted strongly with the bar specific probe when they were analyzed by Southern blot. Integration of the bar gene was further analyzed by genomic Southern blot DNA extracted from three putative transgenic lines that were PCR positive. These analysis in the three lines revealed that each one had a single-copy T-DNA (Figure 4). No hybridization was noted with the DNA extracted from the control. Similar results had been obtained when different crops were transformed by Agrobacterium tumefaciens with respect to the number of T-DNA insertion (Li et al., 2002; Tsukazaki et al., 2002; Lombari et al., 2003; Khanna and Daggard, 2003). The

Southern blot analysis (Figure 4) confirmed the integration of the bar gene in two independent lines and shows one and two copies of the gene into the genome of these lines Nv 91-42 and Nv 91-56.

Acknowledgement

The financial support of the Flemish Interuniversity Council (VLIR) of Belgium is gratefully acknowledged. We would like to thank PROMUSA-INIBAP for allowing to carried out this research under its umbrella and Prof. Dr. Rony Swennen and Dr. Laszlo Sagi from Laboratory of Tropical Crop Improvement, Katholieke Universiteit Leuven (KUL), Belgium by support our ideas and this work.

REFERENCES

Alvarado-Capó Y, Leiva-Mora M, Dita Rodríguez MA.,Acosta-Suárez M, Cruz-Martín M, Portal N, Kosky RG, García LR, Bermúdez-Caraballoso I, Padrón-Montesino J (2003 Early evaluation of black leaf streak resistance on Musa spp breeding programme by the use mycelium suspension of Mycosphaerella fijiensis En : Jacome, L. (Ed.) Mycosphaerella leaf spot diseases of banana: present status and outlook. Proceedings of the workshop on Mycosphaerella leaf spot diseases. San José Costa Rica. INIBAP. Montpellier

Arinaitwe, G, Remy S, Strosse H, Swennen, R, Sagi L (2004) Agrobacterium and particle bombardment mediated transformation of a wide range of banana cultivars In: Mohan SJ and Swennen R (eds), Banana Improvement: Cellular, Molecular Biology and Induced Mutations, pp. 351- 357. Science Publishers, Inc. Enfield

Cabrera, M J (2002) Embriogénesis somática en Musa (AAB) cv. ‘Navolean’ empleando medios de cultivo líquidos. Tesis para optar por el título de Master en Biotecnología Vegetal. Santa Clara, Cuba. 53 pp.

Chong-Pérez, B, Daniels D, Kosky G, Bermúdez-Caraballoso I, Reyes M, Ocaña B (2002) Transformación genética mediada por Agrobacterium tumefaciens de suspensiones celulares embriogénicas del cultivar híbrido de plátano FHIA-21 (AAAB). Biotecnología Vegetal 2 (1): 43-46

Carlier, J, De Waele D, Escalant JV (2002) Global evaluation of Musa germplasm for resistance to Fusarium wilt, Mycosphaerella leaf spot diseases and nematodes (A.Vézina and C. Picq, eds), INIBAP Technical Guidelines 6. The International Network for the Improvement of Banana and Plantain, Montpellier, France

Cohen, JI (2005) Poorer nations turn to publicly developed GM crops. Nature Biotechnology 23: 27-33

Daniels, D (2003) Desarrollo de la embriogénesis somática y su empleo en la transformación genética por biobalística en el cultivar híbrido de plátano FHIA-21 (Musa sp. AAAB). Tesis para aspirar al grado científico de Doctor en Ciencias Agrícolas. Instituto de biotecnología de las Plantas. Santa Clara. Cuba. 96 p

Dhed’a, D, Dumortier F, Panis B, Vuylsteke D, De Langhe E (1991) Plant regeneration in cell suspension cultures of the cooking banana cv. ‘Bluggoe’ (Musa spp. ABB group). Fruits 46:125-135

FAO (2003) Boletín trimestral FAO de estadísticas. 12 (3-4)

Ganapathi, TR, Higos NS, Balint-Kurti PJ, Arntzen CJ, May GD, Van Eck JM (2001) Agrobacterium-mediated transformation of embryogenic cell suspensions of the banana cultivar Rasthali (AAB). Plant Cell Reports 20:157-162

Gómez-Lim, MA, Gónzález Rodríguez JA, Ortiz Vargas JL, Sandoval J, Aguilar Vega M (2004) Genetic transformation of cv Grande Naine. 1st International Congress on Musa. Penang, Malaysia. Abstracts

Gómez, R, Gilliard T, Barranco LA, Reyes M (2000) Embriogénesis somática en medios líquidos. Maduración y aumento de la germinación en el cultivar híbrido FHIA-18 (AAAB). InfoMusa 9(1):12-16

James, C (2004) Preview: Global status of commercialized Biotech/GM Crops:2004. ISAAA Briefs No. 32, ISAAA, Ithaca, NY

Khanna, H, Daggard GE (2003) Agrobacterium tumefaciens-mediated transformation of wheat using a superbinary vector and a polyamine-supplemented regeneration medium. Plant Cell Report 21: 429-436

Khanna, H, Becker D, Kleidon J, Dale J (2004) Centrifugation assisted Agrobacterium tumefaciens-mediated transformation (CAAT) of embryogenic cell suspensions of banana (Musa spp. Cavendish AAA and Lady finger AAB). Molecular Breeding 14: 239-252

Li, DD, Shi W, Deng XX (2002) Agrobacterium-mediated transformation of embryogenic callases of Ponkan mandarin and the regeneration of plants containing the chimeric ribonuclease gene. Plant Cell Report 21: 153-156

Lombari, P, Ercolano E, El Alaoui H, Chiurazzi M (2003) A new transformation-regeneration procedure in the model legume Lotus japonica: root explants as a source of large numbers of cells susceptible to Agrobacterium –mediated transformation. Plant Cell Report 21: 771-777

Murashige, T, Skoog R (1962) A revised medium for rapid growth and bioassays with tobaco tissue cultures. Plant Physiol 5: 473-497

Pérez, JB (2000) Development and application of Agrobacterium-mediated Genetic Transformation to increase fungus resistance in banana (Musa spp.). Ph. D. Thesis, K. U. Leuven, Belgium. 186 p

Pérez, L (2003) Economic impact and management of black leaf streak disease in Cuba. In: Jacome L, Leproive P, Martin D, Ortiz R, Romero R, Escalant JV (eds) Mycosphaerella leaf spot diseases of bananas: present status and outlook. Proceeding of the workshop on Mycosphaerella leaf spot diseases held in San José, Costa Rica on 20-23 May 2002. INIBAP, Montpellier

Pérez, JN, Agramonte DP, Jiménez FT, Ramírez DG (1999) Informe Final del Proyecto ‘Desarrollo y perfeccionamiento de la propagación masiva en las fases III y IV, enraizamiento y adaptación en caña de azúcar, papa, plátanos y bananos y adaptación de semillas artificiales en caña de azúcar’ IBP, Santa Clara

Remy, S, Coemans B, Buyse S, Moller-Nielsen N, Santos E, De Weerdt G, Swennen R, Sagi L (2002) Promotor tagging in banana. Third International Symposium on Molecular and Cellular Biology of Bananas. Leuven, Belgium. 9-11 September

Strosse, H, Domergue R, Panis B, Escalant JV, Côte F (2003) Banana and plantain embryogenic cell suspensions (A. Vézina and C Picq, eds) INIBAP Technical Guidelines 8. The International Network for the Improvement of Banana and Plantain, Montpellier, France

Swennen, R (2003) Transgenic approaches for resistance to Mycosphaerella leaf spot diseases in Musa spp. In: Jacome L, Leproive P, Martin D, Ortiz R, Romero R, Escalant JV(eds) Mycosphaerella leaf spot diseases of bananas: present status and outlook. Proceeding of the workshop on Mycosphaerella leaf spot diseases held in San José, Costa Rica on 20-23 May 2002. INIBAP, Montpellier

Tsukazaki, H, Kuginuki Y, Aida R, Suzuki T (2002) Agrobacterium-mediated transformation of a doubled haploid line of cabbage. Plant Cell Report 21: 257-262

Yun, DJ, Ibeas, JL, Lee, H, Coca MA, Narasimhan, ML, Uesono Y , Hasegawa PM, Pardo JM, Bressan RA (1998) Osmotin, a plant antifungal protein, subverts signal transduction to enhance fungal cell susceptibility. Mol. Cell. 1: 807-817

Veronese, P, Ruiz MT, Coca MA, Hernandes-Lopez A, Lee H, Ibeas JL, Damsz B, Pardo JM, Hasegawa PM, Bressan A, Narasimhan ML (2003) In defences against Pathogens. Both Plant sentinels and foot soldiers need to know the enemy. Plant Physiology. 31: 1580-1590

Biotecnología Vegetal eISSN 2074-8647, RNPS: 2154. ISSN 1609-1841, RNPS: 0397 Editada por: Instituto de Biotecnología de las Plantas. Universidad Central Marta Abreu de Las Villas. Carretera a Camajuaní km 5.5, Santa Clara, Villa Clara, Cuba CP 54 830 Tel: 53 42200124, e-mail: info@ibp.co.cu

Biotecnología Vegetal está bajo una Licencia Creative Commons Atribución-NoComercial 4.0 Internacional.